How is primer Tm calculated?

The headline value uses the nearest-neighbor model: each adjacent base pair step contributes a stacking enthalpy and entropy (SantaLucia 1998), initiation terms are added for the terminal A·T or G·C pairs, entropy is corrected for salt with 0.368 × (N − 1) × ln[Na⁺], and Tm = ΔH ÷ (ΔS + R ln(Cₜ/4)) − 273.15. The Wallace rule and the salt-adjusted GC formula are shown for comparison.

Why does my Tm differ from NEB, IDT or Thermo calculators?

Each vendor uses its own parameter set, salt correction and buffer defaults. NEB adjusts for its specific polymerase buffers, IDT uses Owczarzy salt corrections with 250 nM oligo and 50 mM Na⁺ by default, and Primer3 defaults to 50 nM. Matching the buffer inputs here brings results within a few degrees; use your polymerase supplier's calculator for the final annealing temperature.

How does Mg²⁺ change primer Tm?

Divalent magnesium stabilizes the duplex much more than sodium. The tool converts it to a sodium equivalent with [Na⁺]eq = [Mon⁺] + 120 × √([Mg²⁺] − [dNTP]) in mM, because dNTPs chelate magnesium. Adding 1.5 mM Mg²⁺ with 0.8 mM total dNTP raises a typical 20-mer Tm by about 5 °C.

What annealing temperature should I use?

A common starting point is 3–5 °C below the lower primer Tm, then optimize with a gradient PCR. Keep the forward and reverse primer Tm within about 5 °C of each other; some high-fidelity polymerases recommend annealing at or above the Tm, so check the enzyme manual.

How do you calculate a physical melting point?

Melting points of pure elements and compounds are experimentally measured physical constants rather than calculated from a simple formula. Mixtures and alloys usually melt over a solidus-to-liquidus range.

What is the difference between melting point and melting temperature?

Melting point and melting temperature refer to the same physical property: the temperature at which a solid transitions to a liquid at standard atmospheric pressure (1 atm). For pure elements and compounds, it equals the freezing point.

How accurate are the values in this table?

Values are taken from standard chemistry references (NIST, CRC Handbook). Melting points can vary slightly due to purity, pressure, and measurement method, so treat them as reference values rather than exact laboratory measurements.

How do I convert Celsius to Kelvin?

Add 273.15 to the Celsius value. For example, 0 °C = 273.15 K, and 1064 °C (gold) = 1337.15 K. The tool performs this conversion automatically.

How do I convert Fahrenheit to Kelvin?

Use K = (°F − 32) × 5/9 + 273.15. For example, 82 °F = (82 − 32) × 5/9 + 273.15 = 300.93 K. To go back, °F = (K − 273.15) × 9/5 + 32. This page's quick converter starts from Celsius, so for direct Fahrenheit or Kelvin input use the Fahrenheit to Kelvin or Kelvin to Fahrenheit converters on top10k.

Which metal melts below 0 °C?

Mercury is the only metal in this table that melts below 0 °C, at about −38.8 °C (−37.8 °F). Caesium (28.4 °C) and gallium (29.8 °C) melt just above typical room temperature.

Why do metals have such high melting points compared to organic substances?

Metals are held together by metallic bonds — a "sea" of delocalized electrons — which require a lot of energy to break. Organic substances like wax or sugar are held by weaker intermolecular forces, so they melt at much lower temperatures.

Can I look up alloys in this tool?

Yes. The table includes common alloys such as steel, brass, bronze, solder, and several aluminum and titanium alloys, alongside pure elements and compounds.

Does atmospheric pressure affect the melting point?

Yes, but only significantly at very high pressures. For most practical purposes at or near 1 atm, the values listed are accurate. Ice is a notable exception — its melting point decreases slightly under high pressure.

Melting Temperature Calculator

Paste a primer (and optionally its partner) to get nearest-neighbor Tm with salt, Mg2+ and primer-concentration corrections, GC content, ΔTm and an annealing-temperature starting point, alongside the Wallace and salt-adjusted formulas.

Primer sequence

Forward primer 5′→3′ (ACGT only) Reverse primer 5′→3′ (optional)

Na⁺ / K⁺ (mM)

Mg²⁺ (mM)

dNTP total (mM)

Primer (nM)

Nearest-neighbor: SantaLucia (1998) unified parameters, entropy salt correction, Mg²⁺ as Na⁺ + 120√(Mg²⁺ − dNTP) (von Ahsen 2001), Cₜ/4 for non-self-complementary oligos. Typical PCR: 50 mM K⁺, 1.5 mM Mg²⁺, 0.8 mM total dNTP. Mismatches, modifications and secondary structure are not modeled.

Primer metrics

Enter a DNA primer sequence to calculate metrics.

Length

GC content

Tm (nearest-neighbor)

Tm in °F

Ta starting point

Method

Method	Formula	Tm

Search Substances

Showing all 82 substances

Display Unit

Quick Converter

Enter temperature in °C

Fahrenheit

—

Kelvin

—

Melting Point Reference Table

°C

Substance	Category	Melting Point (°C)

Reference values are approximate at 1 atm. Alloys, waxes and mixtures commonly melt across a range, while some compounds may decompose before a clean phase transition. Confirm a supplier specification or SDS for safety-critical work.

Quick answer

Primer Tm is best estimated with the nearest-neighbor method: Tm = ΔH ÷ (ΔS + R ln(Cₜ/4)) − 273.15, summing SantaLucia (1998) stacking energies and correcting ΔS for Na⁺ (Mg²⁺ converted with von Ahsen 2001). Quick rules: Wallace Tm = 2(A+T) + 4(G+C) for short oligos; salt-adjusted Tm = 81.5 + 16.6 log10[Na⁺] + 0.41(%GC) − 675/N. Start annealing about 5 °C below the lower primer Tm.

Examples

Primer (50 mM Na⁺, 250 nM)	Nearest-neighbor	Wallace	Salt-adjusted
ATGCATGCATGCATGCATGC (20 nt)	57.7 °C	60.0 °C	46.7 °C
GTAAAACGACGGCCAGT (M13 fwd)	51.7 °C	52.0 °C	41.9 °C
AGCGGATAACAATTTCACACAGGA (24 nt)	56.7 °C	68.0 °C	48.9 °C
Same 20-mer + 1.5 mM Mg²⁺, 0.8 mM dNTP	63.1 °C	60.0 °C	46.7 °C

Paste your primer to get nearest-neighbor Tm, GC% and an annealing start point; add the reverse primer to check the pair.

Summary

This tool estimates DNA oligonucleotide melting temperature the way primer-design software does: nearest-neighbor thermodynamics with the SantaLucia (1998) unified parameters, an entropy salt correction for monovalent ions, Mg²⁺ and dNTP handled with the von Ahsen (2001) monovalent-equivalent formula (as in Primer3), and the primer concentration term. It also shows the Wallace rule and the salt-adjusted GC formula for comparison, checks a forward/reverse pair, and keeps a separate searchable reference of melting points for metals, alloys and common substances. Everything runs in the browser.

How it works

Choose DNA / Primer Tm or the Substances & Metals reference.
For a primer, enter a 5′ to 3′ ACGT sequence and the buffer: monovalent salt (Na⁺/K⁺), Mg²⁺, total dNTP and primer concentration (defaults: 50 mM, 0, 0, 250 nM).
The nearest-neighbor Tm sums ΔH and ΔS for each base step, adds initiation terms, corrects ΔS for salt and solves Tm = ΔH ÷ (ΔS + R ln(Cₜ/4)).
Optionally paste the reverse primer to see both Tm values, the difference and an annealing start point 5 °C below the lower Tm.
For a substance, search the reference table and select a row for unit conversions.
Use the unit buttons or custom converter to switch between °C, °F, and K.

Use cases

Estimate primer Tm and an initial PCR annealing-temperature starting point.
Check that a forward and reverse primer pair have matched Tm values before ordering.
See how Mg²⁺, dNTP and primer concentration shift Tm in your PCR buffer.
Verify a reference melting point before machining or casting.
Compare melting temperatures of different alloys side by side.
Convert a literature melting point from Celsius to Fahrenheit or Kelvin.
Quick reference for chemistry homework or lab prep.
Identify which substances stay solid or liquid at a given process temperature.
Educational demos of the wide range of melting points across the periodic table.

Frequently Asked Questions

Last updated: 2026-10-10 · Reviewed by Nham Vu